ID: 1076152910

View in Genome Browser
Species Human (GRCh38)
Location 10:128177928-128177950
Sequence TGGTTATGGGGGCGGGTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076152910_1076152919 -10 Left 1076152910 10:128177928-128177950 CCTGTGACCCGCCCCCATAACCA No data
Right 1076152919 10:128177941-128177963 CCCATAACCAGGCTGGCCTTGGG No data
1076152910_1076152924 4 Left 1076152910 10:128177928-128177950 CCTGTGACCCGCCCCCATAACCA No data
Right 1076152924 10:128177955-128177977 GGCCTTGGGGGAGAGACCGCCGG No data
1076152910_1076152921 -9 Left 1076152910 10:128177928-128177950 CCTGTGACCCGCCCCCATAACCA No data
Right 1076152921 10:128177942-128177964 CCATAACCAGGCTGGCCTTGGGG No data
1076152910_1076152922 -8 Left 1076152910 10:128177928-128177950 CCTGTGACCCGCCCCCATAACCA No data
Right 1076152922 10:128177943-128177965 CATAACCAGGCTGGCCTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076152910 Original CRISPR TGGTTATGGGGGCGGGTCAC AGG (reversed) Intergenic