ID: 1076152911

View in Genome Browser
Species Human (GRCh38)
Location 10:128177930-128177952
Sequence TGTGACCCGCCCCCATAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076152906_1076152911 -7 Left 1076152906 10:128177914-128177936 CCAAGGGACGGCCCCCTGTGACC No data
Right 1076152911 10:128177930-128177952 TGTGACCCGCCCCCATAACCAGG No data
1076152902_1076152911 12 Left 1076152902 10:128177895-128177917 CCTGCGTTTCTGCTGCAGGCCAA No data
Right 1076152911 10:128177930-128177952 TGTGACCCGCCCCCATAACCAGG No data
1076152897_1076152911 24 Left 1076152897 10:128177883-128177905 CCTGCCCCACAGCCTGCGTTTCT No data
Right 1076152911 10:128177930-128177952 TGTGACCCGCCCCCATAACCAGG No data
1076152900_1076152911 18 Left 1076152900 10:128177889-128177911 CCACAGCCTGCGTTTCTGCTGCA No data
Right 1076152911 10:128177930-128177952 TGTGACCCGCCCCCATAACCAGG No data
1076152898_1076152911 20 Left 1076152898 10:128177887-128177909 CCCCACAGCCTGCGTTTCTGCTG No data
Right 1076152911 10:128177930-128177952 TGTGACCCGCCCCCATAACCAGG No data
1076152899_1076152911 19 Left 1076152899 10:128177888-128177910 CCCACAGCCTGCGTTTCTGCTGC No data
Right 1076152911 10:128177930-128177952 TGTGACCCGCCCCCATAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076152911 Original CRISPR TGTGACCCGCCCCCATAACC AGG Intergenic
No off target data available for this crispr