ID: 1076152912

View in Genome Browser
Species Human (GRCh38)
Location 10:128177934-128177956
Sequence ACCCGCCCCCATAACCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076152899_1076152912 23 Left 1076152899 10:128177888-128177910 CCCACAGCCTGCGTTTCTGCTGC No data
Right 1076152912 10:128177934-128177956 ACCCGCCCCCATAACCAGGCTGG No data
1076152897_1076152912 28 Left 1076152897 10:128177883-128177905 CCTGCCCCACAGCCTGCGTTTCT No data
Right 1076152912 10:128177934-128177956 ACCCGCCCCCATAACCAGGCTGG No data
1076152902_1076152912 16 Left 1076152902 10:128177895-128177917 CCTGCGTTTCTGCTGCAGGCCAA No data
Right 1076152912 10:128177934-128177956 ACCCGCCCCCATAACCAGGCTGG No data
1076152898_1076152912 24 Left 1076152898 10:128177887-128177909 CCCCACAGCCTGCGTTTCTGCTG No data
Right 1076152912 10:128177934-128177956 ACCCGCCCCCATAACCAGGCTGG No data
1076152906_1076152912 -3 Left 1076152906 10:128177914-128177936 CCAAGGGACGGCCCCCTGTGACC No data
Right 1076152912 10:128177934-128177956 ACCCGCCCCCATAACCAGGCTGG No data
1076152900_1076152912 22 Left 1076152900 10:128177889-128177911 CCACAGCCTGCGTTTCTGCTGCA No data
Right 1076152912 10:128177934-128177956 ACCCGCCCCCATAACCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076152912 Original CRISPR ACCCGCCCCCATAACCAGGC TGG Intergenic