ID: 1076152921

View in Genome Browser
Species Human (GRCh38)
Location 10:128177942-128177964
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076152902_1076152921 24 Left 1076152902 10:128177895-128177917 CCTGCGTTTCTGCTGCAGGCCAA No data
Right 1076152921 10:128177942-128177964 CCATAACCAGGCTGGCCTTGGGG No data
1076152910_1076152921 -9 Left 1076152910 10:128177928-128177950 CCTGTGACCCGCCCCCATAACCA No data
Right 1076152921 10:128177942-128177964 CCATAACCAGGCTGGCCTTGGGG No data
1076152907_1076152921 -6 Left 1076152907 10:128177925-128177947 CCCCCTGTGACCCGCCCCCATAA No data
Right 1076152921 10:128177942-128177964 CCATAACCAGGCTGGCCTTGGGG No data
1076152900_1076152921 30 Left 1076152900 10:128177889-128177911 CCACAGCCTGCGTTTCTGCTGCA No data
Right 1076152921 10:128177942-128177964 CCATAACCAGGCTGGCCTTGGGG No data
1076152906_1076152921 5 Left 1076152906 10:128177914-128177936 CCAAGGGACGGCCCCCTGTGACC No data
Right 1076152921 10:128177942-128177964 CCATAACCAGGCTGGCCTTGGGG No data
1076152909_1076152921 -8 Left 1076152909 10:128177927-128177949 CCCTGTGACCCGCCCCCATAACC No data
Right 1076152921 10:128177942-128177964 CCATAACCAGGCTGGCCTTGGGG No data
1076152908_1076152921 -7 Left 1076152908 10:128177926-128177948 CCCCTGTGACCCGCCCCCATAAC No data
Right 1076152921 10:128177942-128177964 CCATAACCAGGCTGGCCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076152921 Original CRISPR CCATAACCAGGCTGGCCTTG GGG Intergenic