ID: 1076152924

View in Genome Browser
Species Human (GRCh38)
Location 10:128177955-128177977
Sequence GGCCTTGGGGGAGAGACCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076152914_1076152924 -4 Left 1076152914 10:128177936-128177958 CCGCCCCCATAACCAGGCTGGCC No data
Right 1076152924 10:128177955-128177977 GGCCTTGGGGGAGAGACCGCCGG No data
1076152920_1076152924 -10 Left 1076152920 10:128177942-128177964 CCATAACCAGGCTGGCCTTGGGG No data
Right 1076152924 10:128177955-128177977 GGCCTTGGGGGAGAGACCGCCGG No data
1076152909_1076152924 5 Left 1076152909 10:128177927-128177949 CCCTGTGACCCGCCCCCATAACC No data
Right 1076152924 10:128177955-128177977 GGCCTTGGGGGAGAGACCGCCGG No data
1076152916_1076152924 -8 Left 1076152916 10:128177940-128177962 CCCCATAACCAGGCTGGCCTTGG No data
Right 1076152924 10:128177955-128177977 GGCCTTGGGGGAGAGACCGCCGG No data
1076152907_1076152924 7 Left 1076152907 10:128177925-128177947 CCCCCTGTGACCCGCCCCCATAA No data
Right 1076152924 10:128177955-128177977 GGCCTTGGGGGAGAGACCGCCGG No data
1076152908_1076152924 6 Left 1076152908 10:128177926-128177948 CCCCTGTGACCCGCCCCCATAAC No data
Right 1076152924 10:128177955-128177977 GGCCTTGGGGGAGAGACCGCCGG No data
1076152910_1076152924 4 Left 1076152910 10:128177928-128177950 CCTGTGACCCGCCCCCATAACCA No data
Right 1076152924 10:128177955-128177977 GGCCTTGGGGGAGAGACCGCCGG No data
1076152915_1076152924 -7 Left 1076152915 10:128177939-128177961 CCCCCATAACCAGGCTGGCCTTG No data
Right 1076152924 10:128177955-128177977 GGCCTTGGGGGAGAGACCGCCGG No data
1076152913_1076152924 -3 Left 1076152913 10:128177935-128177957 CCCGCCCCCATAACCAGGCTGGC No data
Right 1076152924 10:128177955-128177977 GGCCTTGGGGGAGAGACCGCCGG No data
1076152906_1076152924 18 Left 1076152906 10:128177914-128177936 CCAAGGGACGGCCCCCTGTGACC No data
Right 1076152924 10:128177955-128177977 GGCCTTGGGGGAGAGACCGCCGG No data
1076152918_1076152924 -9 Left 1076152918 10:128177941-128177963 CCCATAACCAGGCTGGCCTTGGG No data
Right 1076152924 10:128177955-128177977 GGCCTTGGGGGAGAGACCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076152924 Original CRISPR GGCCTTGGGGGAGAGACCGC CGG Intergenic