ID: 1076156909

View in Genome Browser
Species Human (GRCh38)
Location 10:128211341-128211363
Sequence TCGCCCGGTCTCTCCGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076156900_1076156909 15 Left 1076156900 10:128211303-128211325 CCAGGCCGCTGCCAGGCTCTGAC No data
Right 1076156909 10:128211341-128211363 TCGCCCGGTCTCTCCGGAGGTGG No data
1076156902_1076156909 10 Left 1076156902 10:128211308-128211330 CCGCTGCCAGGCTCTGACGCGGT No data
Right 1076156909 10:128211341-128211363 TCGCCCGGTCTCTCCGGAGGTGG No data
1076156904_1076156909 4 Left 1076156904 10:128211314-128211336 CCAGGCTCTGACGCGGTTGCGGA No data
Right 1076156909 10:128211341-128211363 TCGCCCGGTCTCTCCGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076156909 Original CRISPR TCGCCCGGTCTCTCCGGAGG TGG Intergenic
No off target data available for this crispr