ID: 1076157935

View in Genome Browser
Species Human (GRCh38)
Location 10:128217543-128217565
Sequence TAAGATGGAGATGAGTTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076157935_1076157938 2 Left 1076157935 10:128217543-128217565 CCTTTTAACTCATCTCCATCTTA No data
Right 1076157938 10:128217568-128217590 AACACTGAGAAGATATAGGAAGG No data
1076157935_1076157939 3 Left 1076157935 10:128217543-128217565 CCTTTTAACTCATCTCCATCTTA No data
Right 1076157939 10:128217569-128217591 ACACTGAGAAGATATAGGAAGGG No data
1076157935_1076157937 -2 Left 1076157935 10:128217543-128217565 CCTTTTAACTCATCTCCATCTTA No data
Right 1076157937 10:128217564-128217586 TATAAACACTGAGAAGATATAGG No data
1076157935_1076157941 19 Left 1076157935 10:128217543-128217565 CCTTTTAACTCATCTCCATCTTA No data
Right 1076157941 10:128217585-128217607 GGAAGGGCAAAGTGGAGACTAGG No data
1076157935_1076157940 11 Left 1076157935 10:128217543-128217565 CCTTTTAACTCATCTCCATCTTA No data
Right 1076157940 10:128217577-128217599 AAGATATAGGAAGGGCAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076157935 Original CRISPR TAAGATGGAGATGAGTTAAA AGG (reversed) Intergenic
No off target data available for this crispr