ID: 1076157936

View in Genome Browser
Species Human (GRCh38)
Location 10:128217558-128217580
Sequence TCTTCTCAGTGTTTATAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076157936_1076157941 4 Left 1076157936 10:128217558-128217580 CCATCTTATAAACACTGAGAAGA No data
Right 1076157941 10:128217585-128217607 GGAAGGGCAAAGTGGAGACTAGG No data
1076157936_1076157940 -4 Left 1076157936 10:128217558-128217580 CCATCTTATAAACACTGAGAAGA No data
Right 1076157940 10:128217577-128217599 AAGATATAGGAAGGGCAAAGTGG No data
1076157936_1076157942 30 Left 1076157936 10:128217558-128217580 CCATCTTATAAACACTGAGAAGA No data
Right 1076157942 10:128217611-128217633 ATTACAGTAATATAGCTTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076157936 Original CRISPR TCTTCTCAGTGTTTATAAGA TGG (reversed) Intergenic