ID: 1076157937

View in Genome Browser
Species Human (GRCh38)
Location 10:128217564-128217586
Sequence TATAAACACTGAGAAGATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076157935_1076157937 -2 Left 1076157935 10:128217543-128217565 CCTTTTAACTCATCTCCATCTTA No data
Right 1076157937 10:128217564-128217586 TATAAACACTGAGAAGATATAGG No data
1076157932_1076157937 30 Left 1076157932 10:128217511-128217533 CCTATAATTAAAAAAGGGCTTTG No data
Right 1076157937 10:128217564-128217586 TATAAACACTGAGAAGATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076157937 Original CRISPR TATAAACACTGAGAAGATAT AGG Intergenic