ID: 1076157938

View in Genome Browser
Species Human (GRCh38)
Location 10:128217568-128217590
Sequence AACACTGAGAAGATATAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076157935_1076157938 2 Left 1076157935 10:128217543-128217565 CCTTTTAACTCATCTCCATCTTA No data
Right 1076157938 10:128217568-128217590 AACACTGAGAAGATATAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076157938 Original CRISPR AACACTGAGAAGATATAGGA AGG Intergenic