ID: 1076157939

View in Genome Browser
Species Human (GRCh38)
Location 10:128217569-128217591
Sequence ACACTGAGAAGATATAGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076157935_1076157939 3 Left 1076157935 10:128217543-128217565 CCTTTTAACTCATCTCCATCTTA No data
Right 1076157939 10:128217569-128217591 ACACTGAGAAGATATAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076157939 Original CRISPR ACACTGAGAAGATATAGGAA GGG Intergenic