ID: 1076157940 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:128217577-128217599 |
Sequence | AAGATATAGGAAGGGCAAAG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1076157936_1076157940 | -4 | Left | 1076157936 | 10:128217558-128217580 | CCATCTTATAAACACTGAGAAGA | No data | ||
Right | 1076157940 | 10:128217577-128217599 | AAGATATAGGAAGGGCAAAGTGG | No data | ||||
1076157935_1076157940 | 11 | Left | 1076157935 | 10:128217543-128217565 | CCTTTTAACTCATCTCCATCTTA | No data | ||
Right | 1076157940 | 10:128217577-128217599 | AAGATATAGGAAGGGCAAAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1076157940 | Original CRISPR | AAGATATAGGAAGGGCAAAG TGG | Intergenic | ||