ID: 1076157940

View in Genome Browser
Species Human (GRCh38)
Location 10:128217577-128217599
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076157936_1076157940 -4 Left 1076157936 10:128217558-128217580 CCATCTTATAAACACTGAGAAGA No data
Right 1076157940 10:128217577-128217599 AAGATATAGGAAGGGCAAAGTGG No data
1076157935_1076157940 11 Left 1076157935 10:128217543-128217565 CCTTTTAACTCATCTCCATCTTA No data
Right 1076157940 10:128217577-128217599 AAGATATAGGAAGGGCAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076157940 Original CRISPR AAGATATAGGAAGGGCAAAG TGG Intergenic