ID: 1076157942

View in Genome Browser
Species Human (GRCh38)
Location 10:128217611-128217633
Sequence ATTACAGTAATATAGCTTCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076157936_1076157942 30 Left 1076157936 10:128217558-128217580 CCATCTTATAAACACTGAGAAGA No data
Right 1076157942 10:128217611-128217633 ATTACAGTAATATAGCTTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076157942 Original CRISPR ATTACAGTAATATAGCTTCT CGG Intergenic
No off target data available for this crispr