ID: 1076159777

View in Genome Browser
Species Human (GRCh38)
Location 10:128234846-128234868
Sequence TATCTCAAGTATTGTGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076159777_1076159783 17 Left 1076159777 10:128234846-128234868 CCAGAAACACAATACTTGAGATA No data
Right 1076159783 10:128234886-128234908 CCAGAGAGAGTCCCTGGGCCTGG No data
1076159777_1076159780 12 Left 1076159777 10:128234846-128234868 CCAGAAACACAATACTTGAGATA No data
Right 1076159780 10:128234881-128234903 GCCAGCCAGAGAGAGTCCCTGGG No data
1076159777_1076159778 -10 Left 1076159777 10:128234846-128234868 CCAGAAACACAATACTTGAGATA No data
Right 1076159778 10:128234859-128234881 ACTTGAGATATACAAGTACGTGG No data
1076159777_1076159779 11 Left 1076159777 10:128234846-128234868 CCAGAAACACAATACTTGAGATA No data
Right 1076159779 10:128234880-128234902 GGCCAGCCAGAGAGAGTCCCTGG No data
1076159777_1076159786 28 Left 1076159777 10:128234846-128234868 CCAGAAACACAATACTTGAGATA No data
Right 1076159786 10:128234897-128234919 CCCTGGGCCTGGAGGCCAGATGG No data
1076159777_1076159784 20 Left 1076159777 10:128234846-128234868 CCAGAAACACAATACTTGAGATA No data
Right 1076159784 10:128234889-128234911 GAGAGAGTCCCTGGGCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076159777 Original CRISPR TATCTCAAGTATTGTGTTTC TGG (reversed) Intergenic
No off target data available for this crispr