ID: 1076159781

View in Genome Browser
Species Human (GRCh38)
Location 10:128234882-128234904
Sequence GCCCAGGGACTCTCTCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076159781_1076159792 9 Left 1076159781 10:128234882-128234904 CCAGCCAGAGAGAGTCCCTGGGC No data
Right 1076159792 10:128234914-128234936 AGATGGCAGCCAGGAATGCAGGG No data
1076159781_1076159795 20 Left 1076159781 10:128234882-128234904 CCAGCCAGAGAGAGTCCCTGGGC No data
Right 1076159795 10:128234925-128234947 AGGAATGCAGGGCTCTCCCTGGG No data
1076159781_1076159791 8 Left 1076159781 10:128234882-128234904 CCAGCCAGAGAGAGTCCCTGGGC No data
Right 1076159791 10:128234913-128234935 CAGATGGCAGCCAGGAATGCAGG No data
1076159781_1076159796 21 Left 1076159781 10:128234882-128234904 CCAGCCAGAGAGAGTCCCTGGGC No data
Right 1076159796 10:128234926-128234948 GGAATGCAGGGCTCTCCCTGGGG No data
1076159781_1076159797 28 Left 1076159781 10:128234882-128234904 CCAGCCAGAGAGAGTCCCTGGGC No data
Right 1076159797 10:128234933-128234955 AGGGCTCTCCCTGGGGCTGCAGG No data
1076159781_1076159794 19 Left 1076159781 10:128234882-128234904 CCAGCCAGAGAGAGTCCCTGGGC No data
Right 1076159794 10:128234924-128234946 CAGGAATGCAGGGCTCTCCCTGG No data
1076159781_1076159789 0 Left 1076159781 10:128234882-128234904 CCAGCCAGAGAGAGTCCCTGGGC No data
Right 1076159789 10:128234905-128234927 CTGGAGGCCAGATGGCAGCCAGG No data
1076159781_1076159786 -8 Left 1076159781 10:128234882-128234904 CCAGCCAGAGAGAGTCCCTGGGC No data
Right 1076159786 10:128234897-128234919 CCCTGGGCCTGGAGGCCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076159781 Original CRISPR GCCCAGGGACTCTCTCTGGC TGG (reversed) Intergenic
No off target data available for this crispr