ID: 1076159786

View in Genome Browser
Species Human (GRCh38)
Location 10:128234897-128234919
Sequence CCCTGGGCCTGGAGGCCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076159777_1076159786 28 Left 1076159777 10:128234846-128234868 CCAGAAACACAATACTTGAGATA No data
Right 1076159786 10:128234897-128234919 CCCTGGGCCTGGAGGCCAGATGG No data
1076159781_1076159786 -8 Left 1076159781 10:128234882-128234904 CCAGCCAGAGAGAGTCCCTGGGC No data
Right 1076159786 10:128234897-128234919 CCCTGGGCCTGGAGGCCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076159786 Original CRISPR CCCTGGGCCTGGAGGCCAGA TGG Intergenic
No off target data available for this crispr