ID: 1076161413

View in Genome Browser
Species Human (GRCh38)
Location 10:128246875-128246897
Sequence CCTCCATCACTTTTGGTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076161403_1076161413 12 Left 1076161403 10:128246840-128246862 CCTGGGAGCTTGCTCACATGCAG No data
Right 1076161413 10:128246875-128246897 CCTCCATCACTTTTGGTTCAGGG No data
1076161401_1076161413 14 Left 1076161401 10:128246838-128246860 CCCCTGGGAGCTTGCTCACATGC No data
Right 1076161413 10:128246875-128246897 CCTCCATCACTTTTGGTTCAGGG No data
1076161402_1076161413 13 Left 1076161402 10:128246839-128246861 CCCTGGGAGCTTGCTCACATGCA No data
Right 1076161413 10:128246875-128246897 CCTCCATCACTTTTGGTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076161413 Original CRISPR CCTCCATCACTTTTGGTTCA GGG Intergenic
No off target data available for this crispr