ID: 1076165308

View in Genome Browser
Species Human (GRCh38)
Location 10:128277578-128277600
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076165304_1076165308 11 Left 1076165304 10:128277544-128277566 CCTTTAACTTTTAACACGCTTCT No data
Right 1076165308 10:128277578-128277600 GAGCAGGACTCACACGGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076165308 Original CRISPR GAGCAGGACTCACACGGAAA TGG Intergenic
No off target data available for this crispr