ID: 1076165875

View in Genome Browser
Species Human (GRCh38)
Location 10:128282143-128282165
Sequence TGCAGTAGGCTGTGCCATCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076165875_1076165883 23 Left 1076165875 10:128282143-128282165 CCTCGATGGCACAGCCTACTGCA No data
Right 1076165883 10:128282189-128282211 GCTGCTCCTGGGCCACACGCCGG No data
1076165875_1076165880 11 Left 1076165875 10:128282143-128282165 CCTCGATGGCACAGCCTACTGCA No data
Right 1076165880 10:128282177-128282199 AACGCATGGCCTGCTGCTCCTGG No data
1076165875_1076165881 12 Left 1076165875 10:128282143-128282165 CCTCGATGGCACAGCCTACTGCA No data
Right 1076165881 10:128282178-128282200 ACGCATGGCCTGCTGCTCCTGGG No data
1076165875_1076165878 -3 Left 1076165875 10:128282143-128282165 CCTCGATGGCACAGCCTACTGCA No data
Right 1076165878 10:128282163-128282185 GCACACCTAGGCTAAACGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076165875 Original CRISPR TGCAGTAGGCTGTGCCATCG AGG (reversed) Intergenic
No off target data available for this crispr