ID: 1076165879

View in Genome Browser
Species Human (GRCh38)
Location 10:128282168-128282190
Sequence GCAGGCCATGCGTTTAGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076165879_1076165887 29 Left 1076165879 10:128282168-128282190 CCTAGGCTAAACGCATGGCCTGC No data
Right 1076165887 10:128282220-128282242 GCGATTGTACTGAATACTGCAGG No data
1076165879_1076165883 -2 Left 1076165879 10:128282168-128282190 CCTAGGCTAAACGCATGGCCTGC No data
Right 1076165883 10:128282189-128282211 GCTGCTCCTGGGCCACACGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076165879 Original CRISPR GCAGGCCATGCGTTTAGCCT AGG (reversed) Intergenic
No off target data available for this crispr