ID: 1076165880

View in Genome Browser
Species Human (GRCh38)
Location 10:128282177-128282199
Sequence AACGCATGGCCTGCTGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076165875_1076165880 11 Left 1076165875 10:128282143-128282165 CCTCGATGGCACAGCCTACTGCA No data
Right 1076165880 10:128282177-128282199 AACGCATGGCCTGCTGCTCCTGG No data
1076165877_1076165880 -3 Left 1076165877 10:128282157-128282179 CCTACTGCACACCTAGGCTAAAC No data
Right 1076165880 10:128282177-128282199 AACGCATGGCCTGCTGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076165880 Original CRISPR AACGCATGGCCTGCTGCTCC TGG Intergenic
No off target data available for this crispr