ID: 1076165883

View in Genome Browser
Species Human (GRCh38)
Location 10:128282189-128282211
Sequence GCTGCTCCTGGGCCACACGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076165877_1076165883 9 Left 1076165877 10:128282157-128282179 CCTACTGCACACCTAGGCTAAAC No data
Right 1076165883 10:128282189-128282211 GCTGCTCCTGGGCCACACGCCGG No data
1076165875_1076165883 23 Left 1076165875 10:128282143-128282165 CCTCGATGGCACAGCCTACTGCA No data
Right 1076165883 10:128282189-128282211 GCTGCTCCTGGGCCACACGCCGG No data
1076165879_1076165883 -2 Left 1076165879 10:128282168-128282190 CCTAGGCTAAACGCATGGCCTGC No data
Right 1076165883 10:128282189-128282211 GCTGCTCCTGGGCCACACGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076165883 Original CRISPR GCTGCTCCTGGGCCACACGC CGG Intergenic
No off target data available for this crispr