ID: 1076168882 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:128303880-128303902 |
| Sequence | ATAAAACTGGAGGAGGATAT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1076168882_1076168893 | 29 | Left | 1076168882 | 10:128303880-128303902 | CCAATATCCTCCTCCAGTTTTAT | No data | ||
| Right | 1076168893 | 10:128303932-128303954 | TCTGGCCACACTGAACCACTTGG | No data | ||||
| 1076168882_1076168888 | 11 | Left | 1076168882 | 10:128303880-128303902 | CCAATATCCTCCTCCAGTTTTAT | No data | ||
| Right | 1076168888 | 10:128303914-128303936 | CTGACCACATCCCCATGCTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1076168882 | Original CRISPR | ATAAAACTGGAGGAGGATAT TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||