ID: 1076168882

View in Genome Browser
Species Human (GRCh38)
Location 10:128303880-128303902
Sequence ATAAAACTGGAGGAGGATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076168882_1076168893 29 Left 1076168882 10:128303880-128303902 CCAATATCCTCCTCCAGTTTTAT No data
Right 1076168893 10:128303932-128303954 TCTGGCCACACTGAACCACTTGG No data
1076168882_1076168888 11 Left 1076168882 10:128303880-128303902 CCAATATCCTCCTCCAGTTTTAT No data
Right 1076168888 10:128303914-128303936 CTGACCACATCCCCATGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076168882 Original CRISPR ATAAAACTGGAGGAGGATAT TGG (reversed) Intergenic
No off target data available for this crispr