ID: 1076168883

View in Genome Browser
Species Human (GRCh38)
Location 10:128303887-128303909
Sequence AGCAGAGATAAAACTGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076168883_1076168893 22 Left 1076168883 10:128303887-128303909 CCTCCTCCAGTTTTATCTCTGCT No data
Right 1076168893 10:128303932-128303954 TCTGGCCACACTGAACCACTTGG No data
1076168883_1076168888 4 Left 1076168883 10:128303887-128303909 CCTCCTCCAGTTTTATCTCTGCT No data
Right 1076168888 10:128303914-128303936 CTGACCACATCCCCATGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076168883 Original CRISPR AGCAGAGATAAAACTGGAGG AGG (reversed) Intergenic
No off target data available for this crispr