ID: 1076168885

View in Genome Browser
Species Human (GRCh38)
Location 10:128303893-128303915
Sequence AGGAGGAGCAGAGATAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076168885_1076168888 -2 Left 1076168885 10:128303893-128303915 CCAGTTTTATCTCTGCTCCTCCT No data
Right 1076168888 10:128303914-128303936 CTGACCACATCCCCATGCTCTGG No data
1076168885_1076168893 16 Left 1076168885 10:128303893-128303915 CCAGTTTTATCTCTGCTCCTCCT No data
Right 1076168893 10:128303932-128303954 TCTGGCCACACTGAACCACTTGG No data
1076168885_1076168895 30 Left 1076168885 10:128303893-128303915 CCAGTTTTATCTCTGCTCCTCCT No data
Right 1076168895 10:128303946-128303968 ACCACTTGGTCATTCCAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076168885 Original CRISPR AGGAGGAGCAGAGATAAAAC TGG (reversed) Intergenic
No off target data available for this crispr