ID: 1076168886

View in Genome Browser
Species Human (GRCh38)
Location 10:128303910-128303932
Sequence AGCATGGGGATGTGGTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076168886_1076168897 18 Left 1076168886 10:128303910-128303932 CCTCCTGACCACATCCCCATGCT No data
Right 1076168897 10:128303951-128303973 TTGGTCATTCCAAGACGGTGTGG No data
1076168886_1076168898 19 Left 1076168886 10:128303910-128303932 CCTCCTGACCACATCCCCATGCT No data
Right 1076168898 10:128303952-128303974 TGGTCATTCCAAGACGGTGTGGG No data
1076168886_1076168893 -1 Left 1076168886 10:128303910-128303932 CCTCCTGACCACATCCCCATGCT No data
Right 1076168893 10:128303932-128303954 TCTGGCCACACTGAACCACTTGG No data
1076168886_1076168895 13 Left 1076168886 10:128303910-128303932 CCTCCTGACCACATCCCCATGCT No data
Right 1076168895 10:128303946-128303968 ACCACTTGGTCATTCCAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076168886 Original CRISPR AGCATGGGGATGTGGTCAGG AGG (reversed) Intergenic
No off target data available for this crispr