ID: 1076168889

View in Genome Browser
Species Human (GRCh38)
Location 10:128303918-128303940
Sequence GTGGCCAGAGCATGGGGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076168889_1076168898 11 Left 1076168889 10:128303918-128303940 CCACATCCCCATGCTCTGGCCAC No data
Right 1076168898 10:128303952-128303974 TGGTCATTCCAAGACGGTGTGGG No data
1076168889_1076168895 5 Left 1076168889 10:128303918-128303940 CCACATCCCCATGCTCTGGCCAC No data
Right 1076168895 10:128303946-128303968 ACCACTTGGTCATTCCAAGACGG No data
1076168889_1076168893 -9 Left 1076168889 10:128303918-128303940 CCACATCCCCATGCTCTGGCCAC No data
Right 1076168893 10:128303932-128303954 TCTGGCCACACTGAACCACTTGG No data
1076168889_1076168897 10 Left 1076168889 10:128303918-128303940 CCACATCCCCATGCTCTGGCCAC No data
Right 1076168897 10:128303951-128303973 TTGGTCATTCCAAGACGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076168889 Original CRISPR GTGGCCAGAGCATGGGGATG TGG (reversed) Intergenic
No off target data available for this crispr