ID: 1076168893

View in Genome Browser
Species Human (GRCh38)
Location 10:128303932-128303954
Sequence TCTGGCCACACTGAACCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076168882_1076168893 29 Left 1076168882 10:128303880-128303902 CCAATATCCTCCTCCAGTTTTAT No data
Right 1076168893 10:128303932-128303954 TCTGGCCACACTGAACCACTTGG No data
1076168883_1076168893 22 Left 1076168883 10:128303887-128303909 CCTCCTCCAGTTTTATCTCTGCT No data
Right 1076168893 10:128303932-128303954 TCTGGCCACACTGAACCACTTGG No data
1076168884_1076168893 19 Left 1076168884 10:128303890-128303912 CCTCCAGTTTTATCTCTGCTCCT No data
Right 1076168893 10:128303932-128303954 TCTGGCCACACTGAACCACTTGG No data
1076168887_1076168893 -4 Left 1076168887 10:128303913-128303935 CCTGACCACATCCCCATGCTCTG No data
Right 1076168893 10:128303932-128303954 TCTGGCCACACTGAACCACTTGG No data
1076168881_1076168893 30 Left 1076168881 10:128303879-128303901 CCCAATATCCTCCTCCAGTTTTA No data
Right 1076168893 10:128303932-128303954 TCTGGCCACACTGAACCACTTGG No data
1076168885_1076168893 16 Left 1076168885 10:128303893-128303915 CCAGTTTTATCTCTGCTCCTCCT No data
Right 1076168893 10:128303932-128303954 TCTGGCCACACTGAACCACTTGG No data
1076168889_1076168893 -9 Left 1076168889 10:128303918-128303940 CCACATCCCCATGCTCTGGCCAC No data
Right 1076168893 10:128303932-128303954 TCTGGCCACACTGAACCACTTGG No data
1076168886_1076168893 -1 Left 1076168886 10:128303910-128303932 CCTCCTGACCACATCCCCATGCT No data
Right 1076168893 10:128303932-128303954 TCTGGCCACACTGAACCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076168893 Original CRISPR TCTGGCCACACTGAACCACT TGG Intergenic
No off target data available for this crispr