ID: 1076168898

View in Genome Browser
Species Human (GRCh38)
Location 10:128303952-128303974
Sequence TGGTCATTCCAAGACGGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076168891_1076168898 4 Left 1076168891 10:128303925-128303947 CCCATGCTCTGGCCACACTGAAC No data
Right 1076168898 10:128303952-128303974 TGGTCATTCCAAGACGGTGTGGG No data
1076168887_1076168898 16 Left 1076168887 10:128303913-128303935 CCTGACCACATCCCCATGCTCTG No data
Right 1076168898 10:128303952-128303974 TGGTCATTCCAAGACGGTGTGGG No data
1076168889_1076168898 11 Left 1076168889 10:128303918-128303940 CCACATCCCCATGCTCTGGCCAC No data
Right 1076168898 10:128303952-128303974 TGGTCATTCCAAGACGGTGTGGG No data
1076168894_1076168898 -8 Left 1076168894 10:128303937-128303959 CCACACTGAACCACTTGGTCATT No data
Right 1076168898 10:128303952-128303974 TGGTCATTCCAAGACGGTGTGGG No data
1076168886_1076168898 19 Left 1076168886 10:128303910-128303932 CCTCCTGACCACATCCCCATGCT No data
Right 1076168898 10:128303952-128303974 TGGTCATTCCAAGACGGTGTGGG No data
1076168892_1076168898 3 Left 1076168892 10:128303926-128303948 CCATGCTCTGGCCACACTGAACC No data
Right 1076168898 10:128303952-128303974 TGGTCATTCCAAGACGGTGTGGG No data
1076168890_1076168898 5 Left 1076168890 10:128303924-128303946 CCCCATGCTCTGGCCACACTGAA No data
Right 1076168898 10:128303952-128303974 TGGTCATTCCAAGACGGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076168898 Original CRISPR TGGTCATTCCAAGACGGTGT GGG Intergenic
No off target data available for this crispr