ID: 1076170738

View in Genome Browser
Species Human (GRCh38)
Location 10:128317642-128317664
Sequence TATAGGAATTCCCCACCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076170738_1076170743 12 Left 1076170738 10:128317642-128317664 CCAGAAGGTGGGGAATTCCTATA 0: 1
1: 0
2: 0
3: 3
4: 138
Right 1076170743 10:128317677-128317699 TCTCTCTAAGCAATTTGACCAGG 0: 1
1: 0
2: 0
3: 7
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076170738 Original CRISPR TATAGGAATTCCCCACCTTC TGG (reversed) Intergenic
901828761 1:11879591-11879613 TGTAGAAATCCCACACCTTCAGG - Intergenic
902791136 1:18769076-18769098 TGTTGGCATTTCCCACCTTCTGG + Intergenic
904113631 1:28145921-28145943 TATAGCAAGACCCCACCTCCAGG + Intergenic
907681066 1:56564221-56564243 TAGAGGAATACCTCCCCTTCAGG + Intronic
908850211 1:68368197-68368219 TTTGGGAATTACCCACTTTCAGG + Intergenic
911719345 1:101173513-101173535 TATAAGTATTTCCCAACTTCAGG - Intergenic
918351062 1:183656333-183656355 TTTAACAATTCCCCACCTTTTGG - Intronic
919052548 1:192529269-192529291 TATAGGAATTCCTTTCTTTCCGG - Intergenic
923396612 1:233571969-233571991 GATAGGCATTCCCCAGCTTTGGG + Intergenic
1064495233 10:15902571-15902593 TAAAGGAATCCCCCAACTTTTGG + Intergenic
1064708677 10:18099408-18099430 TATATGAATTGCTCACTTTCAGG - Intergenic
1066750412 10:38650153-38650175 TTTAGGAAATCCCCTCATTCTGG - Intergenic
1068139699 10:52990632-52990654 TTTATAAATTGCCCACCTTCAGG - Intergenic
1068429827 10:56917225-56917247 TTTATAAATTACCCACCTTCAGG - Intergenic
1070006794 10:72432478-72432500 TTTATGAATTACCCAGCTTCAGG - Intronic
1071038946 10:81283044-81283066 GCTAGGAATTCCTCACTTTCTGG + Intergenic
1074803795 10:117027849-117027871 TATAGCAATGCCCCACCTCTTGG - Intronic
1076170738 10:128317642-128317664 TATAGGAATTCCCCACCTTCTGG - Intergenic
1076180095 10:128400357-128400379 TAAAGCCATTCCCCACCATCTGG + Intergenic
1077525103 11:3059436-3059458 TATAGGATTTCCACATCTTTTGG - Intergenic
1082142995 11:48631484-48631506 TATAGAAATTCCCCACTCTTTGG + Intergenic
1084062773 11:66686899-66686921 TACAGGAACTCCCCTCCCTCTGG + Intronic
1084857138 11:71996568-71996590 CATAGGAATTGCCCCCCTCCAGG + Exonic
1091902587 12:4156483-4156505 TTTAAGACTTCACCACCTTCAGG + Intergenic
1093619697 12:21274468-21274490 TATATGATTCCACCACCTTCAGG - Exonic
1095975399 12:47937753-47937775 TATAGGGAATCCCCTCCTTGGGG - Intronic
1098472160 12:70857888-70857910 TAGAGAAATGCCCCAACTTCTGG - Intronic
1099869341 12:88327041-88327063 TACAGCAATGCCCCACTTTCTGG + Intergenic
1107037744 13:35918793-35918815 TATAGACATTCCCCATTTTCAGG - Intronic
1110170814 13:72498350-72498372 TATAGCAATTCCTGAACTTCAGG + Intergenic
1110706546 13:78605837-78605859 AACAGGAATACCCCACCTTGGGG + Intergenic
1111469138 13:88653931-88653953 TTTTGGAATGCCCCACATTCTGG + Intergenic
1112099186 13:96168561-96168583 TATAGGTACACACCACCTTCTGG - Intronic
1116855895 14:49952109-49952131 TATAGCAATTCCCCAGGCTCAGG - Intergenic
1118968324 14:70609411-70609433 TGGAGGCATTCCCCACCTCCTGG - Intergenic
1120406961 14:84102498-84102520 TTTAGCAATGCCCCACTTTCTGG - Intergenic
1124472509 15:30000836-30000858 TTTAGAAATTACCCACCCTCAGG + Intergenic
1126973825 15:54151147-54151169 TATAAGACTCCCCCATCTTCGGG + Intronic
1128834399 15:70797458-70797480 TATGGGAGTTACCCATCTTCTGG + Intergenic
1129181041 15:73875681-73875703 TATGGAAATCTCCCACCTTCAGG - Intronic
1131469940 15:92688034-92688056 TATAGCAATGCCCCACTTTTTGG - Intronic
1133618575 16:7503694-7503716 AATAGGGATTCTCCACCTCCTGG - Intronic
1134768784 16:16785738-16785760 TTTATAAATTCCCCAGCTTCAGG + Intergenic
1135498191 16:22970820-22970842 TGGAGGAATTCTCCATCTTCTGG - Intergenic
1136732301 16:32426923-32426945 TTTAGGAAATCCCCTCATTCTGG + Intergenic
1139656543 16:68390677-68390699 AATAAGAATTCCTAACCTTCTGG + Intronic
1203020780 16_KI270728v1_random:402661-402683 TTTAGGAAATCCCCTCATTCTGG - Intergenic
1203039115 16_KI270728v1_random:675819-675841 TTTAGGAAATCCCCTCATTCTGG - Intergenic
1144413654 17:15024740-15024762 TATATGATTTCCATACCTTCTGG + Intergenic
1148113089 17:45158033-45158055 TACAGTAATTCCCCCTCTTCGGG - Intergenic
1148145912 17:45364787-45364809 TACAGGAAATCACCACTTTCTGG + Intergenic
1149089697 17:52763199-52763221 TATAGACATTCCCCAGCTCCAGG + Intergenic
1151411082 17:73930195-73930217 TAAAAGAATACCCCACCTACTGG + Intergenic
1152777216 17:82210065-82210087 TATAGCACGTCCCAACCTTCTGG - Intronic
1153440742 18:5116694-5116716 TATAGCAATGCCCCAACTCCTGG - Intergenic
1153841563 18:9012629-9012651 TTTATGAATTACCCAGCTTCAGG - Intergenic
1156995928 18:43466632-43466654 TATAGCAATGCCTCACTTTCTGG + Intergenic
1158205408 18:54987265-54987287 TCTAGGATTTCCTCACCTTGAGG + Intergenic
1161877957 19:6926467-6926489 TGAAGTAATTCACCACCTTCAGG - Exonic
1162027533 19:7903104-7903126 GATAGGAATTCTCCACGTCCAGG + Intergenic
925303399 2:2832877-2832899 TGTAGAAAGTCCCCACCTGCAGG - Intergenic
929257845 2:39831355-39831377 TGTAGAAATCACCCACCTTCTGG + Intergenic
929888583 2:45900434-45900456 TATCAGAATTCCCCTCCTTTTGG - Intronic
931273307 2:60721469-60721491 TTTACAAATTACCCACCTTCAGG + Intergenic
931831462 2:66055982-66056004 TCTAGGACTTCCCAGCCTTCAGG + Intergenic
932480635 2:72037019-72037041 GACAGGCACTCCCCACCTTCAGG + Intergenic
934313411 2:91892308-91892330 TTTAGGAAATCCCCTCATTCTGG - Intergenic
936134672 2:109879713-109879735 GCTAGGAATTCCTCACTTTCTGG - Intergenic
936210025 2:110491772-110491794 GCTAGGAATTCCTCACTTTCTGG + Intergenic
936429218 2:112447244-112447266 GCTAGGAATTCCTCACTTTCTGG + Intergenic
937096251 2:119237103-119237125 TTTACAAATTCCCCAGCTTCAGG - Intronic
938134923 2:128748899-128748921 CATCTGAATTCCCCACCCTCTGG - Intergenic
939529351 2:143337616-143337638 TTTAGGAATTTAACACCTTCTGG + Intronic
945719269 2:213398502-213398524 TGTAGGTATGCCCCACCTTGAGG + Intronic
945959833 2:216121582-216121604 TTTATGAGTTCCCCACCCTCAGG + Intronic
948472561 2:238193629-238193651 TATAAGAATTCTCAATCTTCAGG - Intronic
1168805473 20:670049-670071 TCTTGGAATTCCCCACATTCTGG + Intronic
1169813148 20:9629316-9629338 TATAGCAGTTCCCCACTTCCAGG - Intronic
1176116050 20:63432268-63432290 TCTGGGAAGTCCCCACCCTCAGG + Intronic
1180540150 22:16438211-16438233 TTTAGGAAATCCCCTCATTCTGG - Intergenic
951667045 3:25138146-25138168 TAAAGCAATTCCCCAACATCTGG + Intergenic
952117883 3:30204429-30204451 TGTTGAAATTCCTCACCTTCTGG + Intergenic
953264189 3:41370411-41370433 TGTAGAAATCACCCACCTTCTGG - Intronic
953778047 3:45840099-45840121 GATAGGAATTGGCCACCTGCTGG - Intronic
955538263 3:59947720-59947742 CATAGGTGTTCCCCATCTTCTGG + Intronic
955626245 3:60922497-60922519 TCTAGGAGGTACCCACCTTCAGG + Intronic
957768455 3:84657656-84657678 TATAGCAATGCCCCACCTCTTGG - Intergenic
960008534 3:112807503-112807525 TTTATGAATTCTCTACCTTCTGG + Intronic
963722239 3:148875268-148875290 TAAAGGAATTACTCACCTTTTGG - Intronic
964268050 3:154922177-154922199 TATAGCAATGCCCCACCTCTTGG + Intergenic
967765319 3:193272583-193272605 TGTAGTAATTCCCCTGCTTCGGG - Intronic
969908421 4:10419712-10419734 TTTAGGAATTACCCAGTTTCAGG + Intergenic
975735031 4:77372730-77372752 GATAGTAATTCCCCTCCTACTGG + Intronic
976516192 4:85970104-85970126 CATAGGACTTCACCTCCTTCAGG - Intronic
977945615 4:102910357-102910379 TTTAGGAAATCCCCTCATTCTGG - Intronic
980697619 4:136380585-136380607 TCTTGGACTTCCCTACCTTCAGG - Intergenic
982068028 4:151671840-151671862 GATAGGAATTCAGCACCTCCTGG - Intronic
982444034 4:155469311-155469333 TGTAGAAATTACACACCTTCAGG - Intergenic
984290542 4:177788816-177788838 TTTATGAATTACCCACCCTCAGG + Intronic
986566110 5:9116196-9116218 TATAGGAATTCCTGACCCACTGG + Intronic
992799312 5:80281429-80281451 AATAGGCATTCCCTTCCTTCTGG - Intergenic
995874667 5:116777946-116777968 CATTGGAATTCCCTACATTCAGG - Intergenic
998211431 5:140201904-140201926 TAGAGGATTCCCCCACTTTCTGG - Intronic
1000119094 5:158179702-158179724 CATGGGAATCCCTCACCTTCTGG + Intergenic
1003880281 6:10474278-10474300 TTTATGAATTACCCAGCTTCAGG + Intergenic
1004992026 6:21149278-21149300 TACAGGCATGCCCCACCTCCAGG + Intronic
1005745537 6:28833735-28833757 TTTATGGATTCCCCACTTTCTGG - Intergenic
1007354962 6:41307848-41307870 GATATGATTTCACCACCTTCTGG - Intergenic
1010687997 6:78874651-78874673 TATAGAAATTTTCCACCCTCTGG - Intronic
1013728816 6:113137472-113137494 TATACAAATTCCACATCTTCTGG - Intergenic
1014953040 6:127582015-127582037 TTTAACAATTCCCCACCTTTTGG + Intronic
1015727638 6:136315965-136315987 TAAAGGAATTCTCCAGGTTCAGG + Intergenic
1015968065 6:138715068-138715090 TATAGCAATGCCCCACTTCCCGG + Intergenic
1020093450 7:5354355-5354377 TGAAAGAATTCCCCACTTTCAGG - Intronic
1021342100 7:19478097-19478119 TATATGAATTCCTGTCCTTCTGG + Intergenic
1022247220 7:28572048-28572070 TATAAGAATTCCAGACCTGCAGG + Intronic
1025170341 7:56750942-56750964 TATAGGGATCCTCCTCCTTCAGG - Intergenic
1028331285 7:89596010-89596032 TATAGGAATCCCCCTTCTTAAGG + Intergenic
1031576355 7:123419801-123419823 TAGAGGAATCCCATACCTTCAGG + Intergenic
1032096278 7:128939802-128939824 TGTTGGATTTCCCCACCTTCCGG + Intronic
1032348750 7:131140711-131140733 TTTAGAAATTACCCAGCTTCAGG + Intronic
1035050582 7:155996614-155996636 TTTATGAATTCCCCAGCTGCAGG + Intergenic
1037415715 8:18648109-18648131 TATAGCAATTCCCCACTTCTTGG - Intronic
1037528940 8:19755935-19755957 TCTAGGAATTGACCATCTTCCGG + Intronic
1037696117 8:21225569-21225591 TTTAGGATTTCCACACCTTAGGG - Intergenic
1038407790 8:27334842-27334864 TGTAGGAAATCTCCACCTTCAGG - Intronic
1041141854 8:54828609-54828631 TTTATGAATTCCCCAGCCTCAGG + Intergenic
1044307307 8:90652619-90652641 TAAAGGCATTTCCTACCTTCAGG + Intronic
1046888841 8:119399632-119399654 TATAGCAATGCCCCACCTCTTGG - Intergenic
1050174198 9:2852915-2852937 TCTATGAATGCCCCAGCTTCTGG - Intergenic
1052341575 9:27369180-27369202 TCTAGGACTACCACACCTTCTGG + Intronic
1052933785 9:34076752-34076774 TATAGGAGTTCCACACCAGCTGG + Intergenic
1055191840 9:73534017-73534039 TATATAAATTACCCAGCTTCAGG + Intergenic
1059631722 9:116131623-116131645 TCTAGGAATTTCACAGCTTCAGG - Intergenic
1185803202 X:3032089-3032111 TATAAGCATTCCCCAGCCTCTGG - Intronic
1188662466 X:32776353-32776375 TATAGCAATGCCCCACTATCTGG + Intronic
1191987468 X:66997748-66997770 TCTATAAATTCCCCAGCTTCAGG + Intergenic
1194881281 X:99254597-99254619 TACAGCAATGCCCCACTTTCAGG + Intergenic
1194961149 X:100236860-100236882 TACAGAAATCACCCACCTTCTGG + Intergenic
1199330453 X:146552256-146552278 TATAGCAATGCCCCACTTCCTGG + Intergenic
1199898400 X:152148725-152148747 TATGGAAATACCCCACCTACAGG - Intergenic
1201181329 Y:11349803-11349825 TTTAGGAAATCCCCTCATTCTGG - Intergenic