ID: 1076171668

View in Genome Browser
Species Human (GRCh38)
Location 10:128325137-128325159
Sequence GGGCCCCTGCAAGGCAGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076171668_1076171677 21 Left 1076171668 10:128325137-128325159 CCCAACCTGCCTTGCAGGGGCCC No data
Right 1076171677 10:128325181-128325203 TTTTGAATGTGCACACACCAGGG No data
1076171668_1076171676 20 Left 1076171668 10:128325137-128325159 CCCAACCTGCCTTGCAGGGGCCC No data
Right 1076171676 10:128325180-128325202 ATTTTGAATGTGCACACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076171668 Original CRISPR GGGCCCCTGCAAGGCAGGTT GGG (reversed) Intergenic
No off target data available for this crispr