ID: 1076171672

View in Genome Browser
Species Human (GRCh38)
Location 10:128325146-128325168
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076171672_1076171680 28 Left 1076171672 10:128325146-128325168 CCTTGCAGGGGCCCTGGAAACAA No data
Right 1076171680 10:128325197-128325219 ACCAGGGCTTACAGCTGAAGGGG No data
1076171672_1076171676 11 Left 1076171672 10:128325146-128325168 CCTTGCAGGGGCCCTGGAAACAA No data
Right 1076171676 10:128325180-128325202 ATTTTGAATGTGCACACACCAGG No data
1076171672_1076171679 27 Left 1076171672 10:128325146-128325168 CCTTGCAGGGGCCCTGGAAACAA No data
Right 1076171679 10:128325196-128325218 CACCAGGGCTTACAGCTGAAGGG No data
1076171672_1076171678 26 Left 1076171672 10:128325146-128325168 CCTTGCAGGGGCCCTGGAAACAA No data
Right 1076171678 10:128325195-128325217 ACACCAGGGCTTACAGCTGAAGG No data
1076171672_1076171677 12 Left 1076171672 10:128325146-128325168 CCTTGCAGGGGCCCTGGAAACAA No data
Right 1076171677 10:128325181-128325203 TTTTGAATGTGCACACACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076171672 Original CRISPR TTGTTTCCAGGGCCCCTGCA AGG (reversed) Intergenic