ID: 1076171673

View in Genome Browser
Species Human (GRCh38)
Location 10:128325157-128325179
Sequence CATGCTGGTGTTTGTTTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076171673_1076171680 17 Left 1076171673 10:128325157-128325179 CCCTGGAAACAAACACCAGCATG No data
Right 1076171680 10:128325197-128325219 ACCAGGGCTTACAGCTGAAGGGG No data
1076171673_1076171679 16 Left 1076171673 10:128325157-128325179 CCCTGGAAACAAACACCAGCATG No data
Right 1076171679 10:128325196-128325218 CACCAGGGCTTACAGCTGAAGGG No data
1076171673_1076171677 1 Left 1076171673 10:128325157-128325179 CCCTGGAAACAAACACCAGCATG No data
Right 1076171677 10:128325181-128325203 TTTTGAATGTGCACACACCAGGG No data
1076171673_1076171678 15 Left 1076171673 10:128325157-128325179 CCCTGGAAACAAACACCAGCATG No data
Right 1076171678 10:128325195-128325217 ACACCAGGGCTTACAGCTGAAGG No data
1076171673_1076171676 0 Left 1076171673 10:128325157-128325179 CCCTGGAAACAAACACCAGCATG No data
Right 1076171676 10:128325180-128325202 ATTTTGAATGTGCACACACCAGG No data
1076171673_1076171682 25 Left 1076171673 10:128325157-128325179 CCCTGGAAACAAACACCAGCATG No data
Right 1076171682 10:128325205-128325227 TTACAGCTGAAGGGGCTTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076171673 Original CRISPR CATGCTGGTGTTTGTTTCCA GGG (reversed) Intergenic