ID: 1076171674

View in Genome Browser
Species Human (GRCh38)
Location 10:128325158-128325180
Sequence TCATGCTGGTGTTTGTTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076171674_1076171682 24 Left 1076171674 10:128325158-128325180 CCTGGAAACAAACACCAGCATGA No data
Right 1076171682 10:128325205-128325227 TTACAGCTGAAGGGGCTTCTCGG No data
1076171674_1076171680 16 Left 1076171674 10:128325158-128325180 CCTGGAAACAAACACCAGCATGA No data
Right 1076171680 10:128325197-128325219 ACCAGGGCTTACAGCTGAAGGGG No data
1076171674_1076171678 14 Left 1076171674 10:128325158-128325180 CCTGGAAACAAACACCAGCATGA No data
Right 1076171678 10:128325195-128325217 ACACCAGGGCTTACAGCTGAAGG No data
1076171674_1076171677 0 Left 1076171674 10:128325158-128325180 CCTGGAAACAAACACCAGCATGA No data
Right 1076171677 10:128325181-128325203 TTTTGAATGTGCACACACCAGGG No data
1076171674_1076171676 -1 Left 1076171674 10:128325158-128325180 CCTGGAAACAAACACCAGCATGA No data
Right 1076171676 10:128325180-128325202 ATTTTGAATGTGCACACACCAGG No data
1076171674_1076171679 15 Left 1076171674 10:128325158-128325180 CCTGGAAACAAACACCAGCATGA No data
Right 1076171679 10:128325196-128325218 CACCAGGGCTTACAGCTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076171674 Original CRISPR TCATGCTGGTGTTTGTTTCC AGG (reversed) Intergenic
No off target data available for this crispr