ID: 1076171675

View in Genome Browser
Species Human (GRCh38)
Location 10:128325172-128325194
Sequence GTGCACATTCAAAATCATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076171675_1076171682 10 Left 1076171675 10:128325172-128325194 CCAGCATGATTTTGAATGTGCAC No data
Right 1076171682 10:128325205-128325227 TTACAGCTGAAGGGGCTTCTCGG No data
1076171675_1076171678 0 Left 1076171675 10:128325172-128325194 CCAGCATGATTTTGAATGTGCAC No data
Right 1076171678 10:128325195-128325217 ACACCAGGGCTTACAGCTGAAGG No data
1076171675_1076171679 1 Left 1076171675 10:128325172-128325194 CCAGCATGATTTTGAATGTGCAC No data
Right 1076171679 10:128325196-128325218 CACCAGGGCTTACAGCTGAAGGG No data
1076171675_1076171680 2 Left 1076171675 10:128325172-128325194 CCAGCATGATTTTGAATGTGCAC No data
Right 1076171680 10:128325197-128325219 ACCAGGGCTTACAGCTGAAGGGG No data
1076171675_1076171683 24 Left 1076171675 10:128325172-128325194 CCAGCATGATTTTGAATGTGCAC No data
Right 1076171683 10:128325219-128325241 GCTTCTCGGTCAACCAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076171675 Original CRISPR GTGCACATTCAAAATCATGC TGG (reversed) Intergenic