ID: 1076171677

View in Genome Browser
Species Human (GRCh38)
Location 10:128325181-128325203
Sequence TTTTGAATGTGCACACACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076171672_1076171677 12 Left 1076171672 10:128325146-128325168 CCTTGCAGGGGCCCTGGAAACAA No data
Right 1076171677 10:128325181-128325203 TTTTGAATGTGCACACACCAGGG No data
1076171674_1076171677 0 Left 1076171674 10:128325158-128325180 CCTGGAAACAAACACCAGCATGA No data
Right 1076171677 10:128325181-128325203 TTTTGAATGTGCACACACCAGGG No data
1076171668_1076171677 21 Left 1076171668 10:128325137-128325159 CCCAACCTGCCTTGCAGGGGCCC No data
Right 1076171677 10:128325181-128325203 TTTTGAATGTGCACACACCAGGG No data
1076171673_1076171677 1 Left 1076171673 10:128325157-128325179 CCCTGGAAACAAACACCAGCATG No data
Right 1076171677 10:128325181-128325203 TTTTGAATGTGCACACACCAGGG No data
1076171669_1076171677 20 Left 1076171669 10:128325138-128325160 CCAACCTGCCTTGCAGGGGCCCT No data
Right 1076171677 10:128325181-128325203 TTTTGAATGTGCACACACCAGGG No data
1076171667_1076171677 22 Left 1076171667 10:128325136-128325158 CCCCAACCTGCCTTGCAGGGGCC No data
Right 1076171677 10:128325181-128325203 TTTTGAATGTGCACACACCAGGG No data
1076171671_1076171677 16 Left 1076171671 10:128325142-128325164 CCTGCCTTGCAGGGGCCCTGGAA No data
Right 1076171677 10:128325181-128325203 TTTTGAATGTGCACACACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076171677 Original CRISPR TTTTGAATGTGCACACACCA GGG Intergenic
No off target data available for this crispr