ID: 1076171679

View in Genome Browser
Species Human (GRCh38)
Location 10:128325196-128325218
Sequence CACCAGGGCTTACAGCTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076171674_1076171679 15 Left 1076171674 10:128325158-128325180 CCTGGAAACAAACACCAGCATGA No data
Right 1076171679 10:128325196-128325218 CACCAGGGCTTACAGCTGAAGGG No data
1076171672_1076171679 27 Left 1076171672 10:128325146-128325168 CCTTGCAGGGGCCCTGGAAACAA No data
Right 1076171679 10:128325196-128325218 CACCAGGGCTTACAGCTGAAGGG No data
1076171673_1076171679 16 Left 1076171673 10:128325157-128325179 CCCTGGAAACAAACACCAGCATG No data
Right 1076171679 10:128325196-128325218 CACCAGGGCTTACAGCTGAAGGG No data
1076171675_1076171679 1 Left 1076171675 10:128325172-128325194 CCAGCATGATTTTGAATGTGCAC No data
Right 1076171679 10:128325196-128325218 CACCAGGGCTTACAGCTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076171679 Original CRISPR CACCAGGGCTTACAGCTGAA GGG Intergenic
No off target data available for this crispr