ID: 1076171682

View in Genome Browser
Species Human (GRCh38)
Location 10:128325205-128325227
Sequence TTACAGCTGAAGGGGCTTCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076171673_1076171682 25 Left 1076171673 10:128325157-128325179 CCCTGGAAACAAACACCAGCATG No data
Right 1076171682 10:128325205-128325227 TTACAGCTGAAGGGGCTTCTCGG No data
1076171674_1076171682 24 Left 1076171674 10:128325158-128325180 CCTGGAAACAAACACCAGCATGA No data
Right 1076171682 10:128325205-128325227 TTACAGCTGAAGGGGCTTCTCGG No data
1076171675_1076171682 10 Left 1076171675 10:128325172-128325194 CCAGCATGATTTTGAATGTGCAC No data
Right 1076171682 10:128325205-128325227 TTACAGCTGAAGGGGCTTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076171682 Original CRISPR TTACAGCTGAAGGGGCTTCT CGG Intergenic