ID: 1076171683

View in Genome Browser
Species Human (GRCh38)
Location 10:128325219-128325241
Sequence GCTTCTCGGTCAACCAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076171675_1076171683 24 Left 1076171675 10:128325172-128325194 CCAGCATGATTTTGAATGTGCAC No data
Right 1076171683 10:128325219-128325241 GCTTCTCGGTCAACCAGCCCAGG No data
1076171681_1076171683 -2 Left 1076171681 10:128325198-128325220 CCAGGGCTTACAGCTGAAGGGGC No data
Right 1076171683 10:128325219-128325241 GCTTCTCGGTCAACCAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076171683 Original CRISPR GCTTCTCGGTCAACCAGCCC AGG Intergenic