ID: 1076183119

View in Genome Browser
Species Human (GRCh38)
Location 10:128426111-128426133
Sequence CCTTATAAGAAGAGGAAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3138
Summary {0: 9, 1: 140, 2: 478, 3: 958, 4: 1553}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076183119_1076183123 -2 Left 1076183119 10:128426111-128426133 CCAGATTTCCTCTTCTTATAAGG 0: 9
1: 140
2: 478
3: 958
4: 1553
Right 1076183123 10:128426132-128426154 GGAACCAGTCAGGTTGAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076183119 Original CRISPR CCTTATAAGAAGAGGAAATC TGG (reversed) Intergenic
Too many off-targets to display for this crispr