ID: 1076184152

View in Genome Browser
Species Human (GRCh38)
Location 10:128433634-128433656
Sequence CTGGACACACAGCTCAGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076184149_1076184152 7 Left 1076184149 10:128433604-128433626 CCTGCTGCTGCAAACTCACCAAA No data
Right 1076184152 10:128433634-128433656 CTGGACACACAGCTCAGAAAAGG No data
1076184147_1076184152 9 Left 1076184147 10:128433602-128433624 CCCCTGCTGCTGCAAACTCACCA No data
Right 1076184152 10:128433634-128433656 CTGGACACACAGCTCAGAAAAGG No data
1076184148_1076184152 8 Left 1076184148 10:128433603-128433625 CCCTGCTGCTGCAAACTCACCAA No data
Right 1076184152 10:128433634-128433656 CTGGACACACAGCTCAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076184152 Original CRISPR CTGGACACACAGCTCAGAAA AGG Intergenic
No off target data available for this crispr