ID: 1076188041

View in Genome Browser
Species Human (GRCh38)
Location 10:128464135-128464157
Sequence CTCTGACAGGGGAAGGGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076188041_1076188050 20 Left 1076188041 10:128464135-128464157 CCTGGTCCCTTCCCCTGTCAGAG No data
Right 1076188050 10:128464178-128464200 AATTTCTAGCTTATTCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076188041 Original CRISPR CTCTGACAGGGGAAGGGACC AGG (reversed) Intergenic
No off target data available for this crispr