ID: 1076188656

View in Genome Browser
Species Human (GRCh38)
Location 10:128467872-128467894
Sequence CCTTGTGGAGGCCAGAATTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076188652_1076188656 -8 Left 1076188652 10:128467857-128467879 CCAGGTGAGTGACATCCTTGTGG No data
Right 1076188656 10:128467872-128467894 CCTTGTGGAGGCCAGAATTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076188656 Original CRISPR CCTTGTGGAGGCCAGAATTC CGG Intergenic
No off target data available for this crispr