ID: 1076199617

View in Genome Browser
Species Human (GRCh38)
Location 10:128547556-128547578
Sequence CACTCCAGCCCCACCGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076199617_1076199620 1 Left 1076199617 10:128547556-128547578 CCCACCTCGGTGGGGCTGGAGTG No data
Right 1076199620 10:128547580-128547602 TGCTCCTCTGTCAGCCTTGCTGG No data
1076199617_1076199623 14 Left 1076199617 10:128547556-128547578 CCCACCTCGGTGGGGCTGGAGTG No data
Right 1076199623 10:128547593-128547615 GCCTTGCTGGCCTGGCTGTGAGG No data
1076199617_1076199627 27 Left 1076199617 10:128547556-128547578 CCCACCTCGGTGGGGCTGGAGTG No data
Right 1076199627 10:128547606-128547628 GGCTGTGAGGTCACAGCCCAGGG No data
1076199617_1076199628 28 Left 1076199617 10:128547556-128547578 CCCACCTCGGTGGGGCTGGAGTG No data
Right 1076199628 10:128547607-128547629 GCTGTGAGGTCACAGCCCAGGGG No data
1076199617_1076199626 26 Left 1076199617 10:128547556-128547578 CCCACCTCGGTGGGGCTGGAGTG No data
Right 1076199626 10:128547605-128547627 TGGCTGTGAGGTCACAGCCCAGG No data
1076199617_1076199622 6 Left 1076199617 10:128547556-128547578 CCCACCTCGGTGGGGCTGGAGTG No data
Right 1076199622 10:128547585-128547607 CTCTGTCAGCCTTGCTGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076199617 Original CRISPR CACTCCAGCCCCACCGAGGT GGG (reversed) Intergenic
No off target data available for this crispr