ID: 1076200430

View in Genome Browser
Species Human (GRCh38)
Location 10:128553401-128553423
Sequence GGGTGCCGTGATGCAGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076200430_1076200441 20 Left 1076200430 10:128553401-128553423 CCAGCAGCTGCATCACGGCACCC No data
Right 1076200441 10:128553444-128553466 CCTTTACTGCAGAACCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076200430 Original CRISPR GGGTGCCGTGATGCAGCTGC TGG (reversed) Intergenic
No off target data available for this crispr