ID: 1076200552

View in Genome Browser
Species Human (GRCh38)
Location 10:128554414-128554436
Sequence ACTTGCATGTAACTGAAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076200552_1076200558 4 Left 1076200552 10:128554414-128554436 CCTACTTTCAGTTACATGCAAGT No data
Right 1076200558 10:128554441-128554463 GGGTGGGTTAATGTAAACTGAGG No data
1076200552_1076200562 29 Left 1076200552 10:128554414-128554436 CCTACTTTCAGTTACATGCAAGT No data
Right 1076200562 10:128554466-128554488 CAGGTTATTGAGAACTTTCTAGG No data
1076200552_1076200561 10 Left 1076200552 10:128554414-128554436 CCTACTTTCAGTTACATGCAAGT No data
Right 1076200561 10:128554447-128554469 GTTAATGTAAACTGAGGGGCAGG No data
1076200552_1076200560 6 Left 1076200552 10:128554414-128554436 CCTACTTTCAGTTACATGCAAGT No data
Right 1076200560 10:128554443-128554465 GTGGGTTAATGTAAACTGAGGGG No data
1076200552_1076200559 5 Left 1076200552 10:128554414-128554436 CCTACTTTCAGTTACATGCAAGT No data
Right 1076200559 10:128554442-128554464 GGTGGGTTAATGTAAACTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076200552 Original CRISPR ACTTGCATGTAACTGAAAGT AGG (reversed) Intergenic