ID: 1076200558

View in Genome Browser
Species Human (GRCh38)
Location 10:128554441-128554463
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076200552_1076200558 4 Left 1076200552 10:128554414-128554436 CCTACTTTCAGTTACATGCAAGT No data
Right 1076200558 10:128554441-128554463 GGGTGGGTTAATGTAAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076200558 Original CRISPR GGGTGGGTTAATGTAAACTG AGG Intergenic