ID: 1076200560

View in Genome Browser
Species Human (GRCh38)
Location 10:128554443-128554465
Sequence GTGGGTTAATGTAAACTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076200552_1076200560 6 Left 1076200552 10:128554414-128554436 CCTACTTTCAGTTACATGCAAGT No data
Right 1076200560 10:128554443-128554465 GTGGGTTAATGTAAACTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076200560 Original CRISPR GTGGGTTAATGTAAACTGAG GGG Intergenic
No off target data available for this crispr