ID: 1076200561

View in Genome Browser
Species Human (GRCh38)
Location 10:128554447-128554469
Sequence GTTAATGTAAACTGAGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076200552_1076200561 10 Left 1076200552 10:128554414-128554436 CCTACTTTCAGTTACATGCAAGT No data
Right 1076200561 10:128554447-128554469 GTTAATGTAAACTGAGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076200561 Original CRISPR GTTAATGTAAACTGAGGGGC AGG Intergenic
No off target data available for this crispr