ID: 1076201615

View in Genome Browser
Species Human (GRCh38)
Location 10:128563504-128563526
Sequence CTGCTGTTCCAGGACTCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076201603_1076201615 27 Left 1076201603 10:128563454-128563476 CCTCCTGCCTCGCCAGGGGAGCT No data
Right 1076201615 10:128563504-128563526 CTGCTGTTCCAGGACTCAGCAGG No data
1076201610_1076201615 -9 Left 1076201610 10:128563490-128563512 CCAGCCCTTAACACCTGCTGTTC No data
Right 1076201615 10:128563504-128563526 CTGCTGTTCCAGGACTCAGCAGG No data
1076201609_1076201615 -6 Left 1076201609 10:128563487-128563509 CCACCAGCCCTTAACACCTGCTG No data
Right 1076201615 10:128563504-128563526 CTGCTGTTCCAGGACTCAGCAGG No data
1076201605_1076201615 20 Left 1076201605 10:128563461-128563483 CCTCGCCAGGGGAGCTGCTCTCC No data
Right 1076201615 10:128563504-128563526 CTGCTGTTCCAGGACTCAGCAGG No data
1076201607_1076201615 -1 Left 1076201607 10:128563482-128563504 CCCAACCACCAGCCCTTAACACC No data
Right 1076201615 10:128563504-128563526 CTGCTGTTCCAGGACTCAGCAGG No data
1076201606_1076201615 15 Left 1076201606 10:128563466-128563488 CCAGGGGAGCTGCTCTCCCAACC No data
Right 1076201615 10:128563504-128563526 CTGCTGTTCCAGGACTCAGCAGG No data
1076201602_1076201615 30 Left 1076201602 10:128563451-128563473 CCACCTCCTGCCTCGCCAGGGGA No data
Right 1076201615 10:128563504-128563526 CTGCTGTTCCAGGACTCAGCAGG No data
1076201608_1076201615 -2 Left 1076201608 10:128563483-128563505 CCAACCACCAGCCCTTAACACCT No data
Right 1076201615 10:128563504-128563526 CTGCTGTTCCAGGACTCAGCAGG No data
1076201604_1076201615 24 Left 1076201604 10:128563457-128563479 CCTGCCTCGCCAGGGGAGCTGCT No data
Right 1076201615 10:128563504-128563526 CTGCTGTTCCAGGACTCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076201615 Original CRISPR CTGCTGTTCCAGGACTCAGC AGG Intergenic
No off target data available for this crispr